ChrX-STR.org 2.0
This database covers many issues concerning the usage of X-chromosomal markers for forensic purpose



Marker DXS981 (STRX1)

Create date: Jun 25, 2009 12:18:13 PM
Last update: Jun 20, 2012 12:00:00 AM
Cytogenetic localisation: q 13.10
Physical localisation NCBI 36: 68.114
Rutgers Map v.2: 92.81
Reference: Edwards A, Civitello A, Hammond HA, Caskey CT (1991) DNA typing and genetic map...

Primer

PrimerF: 5' - CTCCTTGTGGCCTTCCTTAAATGG - 3'
PrimerR: 5' - CTTCTCCAGCACCCAAGGAAGTCA - 3'

Typical structure

AllelebpsSequence composition
12.3-D(TT)-N81-(TATC)11-(ATC)-(TATC)1
13-TT-N81-(TATC)13
13.3-D(TT)-N81-(TATC)12-(ATC)-(TATC)1
14-TT-N81-(TATC)14
15.3-D(TT)-N81-(TATC)14-(ATC)-(TATC)1
16-TT-N81-(TATC)16
17-TT-N81-(TATC)17
Comment: (N= nucleotides, D(TT)= deletion of ‘TT’)

Cell line DNAAllele
K56213.3
NA9947A13.3, 14.3
References: Tabbada KA, De Ungria MC, Faustino LP, Athanasiadou D, Stradmann-Bellinghausen ...
Shin SH, Yu JS, Park SW, Min GS, Chung KW (2005) Genetic analysis of 18 X-linke...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1ChineseTabbada...0.81430.83440.67290.81430.81430.70180.95250.8344
2GermanyTabbada...0.81700.83740.67620.81740.81700.70540.95320.8374
3JapaneseTabbada...0.80560.82680.66060.80560.80560.69050.94880.8268
4KoreaShin SH...0.80670.82780.66280.80670.80670.69230.94930.8278
5PhilippineTabbada...0.79110.81580.63740.79090.79110.67160.94130.8158
6ThaiTabbada...0.77650.80350.61720.77670.77650.65300.93440.8035
ID Population Ethnic specification Reference n* 9.3 11 11.3 12 12.3 13 13.3 14 14.3 15 15.3 16 16.3 17
1 Chinese Asian Tabbada... 90 0.0200 0.1000 0.1200 0.1700 0.2700 0.0900 0.1700 0.0400 0.0200
2 Germany Caucasian (European) Tabbada... 180 0.0063 0.0063 0.0250 0.0500 0.1938 0.2250 0.2000 0.1063 0.1375 0.0250 0.0188 0.0063
3 Japanese Asian Tabbada... 95 0.0842 0.0316 0.1684 0.0947 0.2842 0.0632 0.1895 0.0842
4 Korea Asian (Korean) Shin SH... 401 0.0080 0.0040 0.0350 0.0730 0.1970 0.1250 0.2780 0.0380 0.1720 0.0100 0.0520 0.0080
5 Philippine Asian Tabbada... 115 0.0058 0.0173 0.0405 0.1965 0.2601 0.2312 0.1040 0.1040 0.0231 0.0173
6 Thai Asian Tabbada... 157 0.0202 0.0303 0.1515 0.2475 0.2879 0.1414 0.0859 0.0051 0.0253 0.0051
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.