ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers



Marker GATA172D05

Create date: Jun 25, 2009 12:18:14 PM
Last update: Sep 27, 2010 1:56:09 PM
Cytogenetic localisation: q 23.00
Physical localisation NCBI 36: 113.061
Genetic localisation deCODE: 110.42
Rutgers Map v.2: 124.36
Reference: Edelmann J, Hering, S, Michael, M, Lessig, R, Deichsel, D, Meier-Sundhausen, G,...

Primer

PrimerF: 5' - TAGTGGTGATGGTTGCACAG - 3'
PrimerR: 5' - ATAATTGAAAGCCCGGATTC - 3'

Typical structure

AllelebpsSequence composition
5-12104-132PF-N5-(TAGA)5-12 N39-PR
Comment: PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (20 bp), N5: ATATA, N39: GCTATATCAATACCTATATCTATAGATATAGATCTTTTT (differences to GDB sequence are underlined)
References: Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Cell line DNAAllele
K562 (BRL)12
K562 (Promega)12
NA36579
NA9947A10, 10
NA99486
References: Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F,...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1Belo Horizonte, BrazilGenetic...0.81380.83560.66800.81380.81380.70010.95120.8356
2GermanyEdelman...0.77530.80370.61190.77530.77530.65060.93310.8037
3KoreaShin KJ...0.71430.74840.53740.71430.71430.57780.90260.7484
4KoreaShin SH...0.70230.73560.52400.70110.70230.56380.89680.7356
5Portugal (North)Pereira...0.75030.78290.57710.75020.75030.61980.92030.7829
6Rio de Janeiro, BrazilGenetic...0.78330.81050.62230.78330.78330.66040.93690.8105
7Spain (Valencia)Aler M,...0.78390.81120.62280.78380.78390.66110.93710.8112
8São Paulo, BrazilGenetic...0.78790.81370.63050.78790.78790.66660.93950.8137
9Vitória, BrazilGenetic...0.79110.81540.63690.79110.79110.67100.94170.8154
ID Population Ethnic specification Reference n* 5 6 7 8 9 10 11 12 13
1 Belo Horizonte, Brazil admixed Genetic... 245 0.1530 0.0369 0.1246 0.1842 0.2068 0.1953 0.0964 0.0028
2 Germany Caucasian (European) Edelman... 503 0.1420 0.0030 0.1730 0.0600 0.2730 0.2370 0.1090 0.0030
3 Korea Asian (Korean) Shin KJ... 300 0.0800 0.0040 0.1560 0.0870 0.4020 0.2220 0.0490
4 Korea Asian (Korean) Shin SH... 401 0.0650 0.0040 0.1380 0.1000 0.4300 0.2080 0.0540
5 Portugal (North) all Pereira... 347 males 0.2017 0.0029 0.1671 0.0375 0.3199 0.1988 0.0720
6 Rio de Janeiro, Brazil admixed Genetic... 261 0.1896 0.0222 0.1724 0.1576 0.2685 0.1601 0.0271 0.0025
7 Spain (Valencia) all Aler M,... 145 females 0.1931 0.0034 0.1586 0.0655 0.2517 0.2138 0.1138
8 São Paulo, Brazil admixed Genetic... 250 0.1473 0.0168 0.1546 0.1256 0.2730 0.2126 0.0701
9 Vitória, Brazil admixed Genetic... 245 0.1481 0.0272 0.1531 0.1407 0.2963 0.1605 0.0716 0.0025
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

No data.

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.