|
Marker DXS10011
Primer
PrimerF: |
5' - |
CTGAGATTGCACCATTGCAC |
- 3' |
PrimerR: |
5' - |
TGGGAGAACCRTTTGAAGTT |
- 3' |
|
|
Comment: |
R: A wobble of A and G is recommended |
Typical structure26-29 | 221-233 | (GAAA)17- 20 GAAG GAAA (GGAA)4 (AGAA)3 | 29.2 | 135 | GAAA GA (GAAA)6 GAGA (GAAA)12 GAAG GAAA (GGAA)4 (AGAA)3 | 30 | 237 | (GAAA)21 GAAG GAAA (GGAA)4 (AGAA)3 | 30.2 | 239 | GAAA GA (GAAA)6 GAGA (GAAA)13 GAAG GAAA (GGAA)4 (AGAA)3 | 31 | 241 | (GAAA)22 GAAG GAAA (GGAA)4 (AGAA)3 | 31.2 | 243 | GAAA GA (GAAA)6 GAGA (GAAA)14 GAAG GAAA (GGAA)4 (AGAA)3 | 32 | 245 | (GAAA)23 GAAG GAAA (GGAA)4 (AGAA)3 | 32.2 | 247 | GAAA GA (GAAA)6 GAGA (GAAA)15 GAAG GAAA (GGAA)4 (AGAA)3 | 32.2* | 247 | GAAA GA (GAAA)7 GAGA (GAAA)14 GAAG GAAA (GGAA)4 (AGAA)3 | 33 | 249 | (GAAA)24 GAAG GAAA (GGAA)4 (AGAA)3 | 33.2 | 251 | GAAA GA (GAAA)6 GAGA (GAAA)16 GAAG GAAA (GGAA)4 (AGAA)3 | 33.2* | 251 | GAAA GA (GAAA)7 GAGA (GAAA)15 GAAG GAAA (GGAA)4 (AGAA)3 | 34 | 253 | (GAAA)25 GAAG GAAA (GGAA)4 (AGAA)3 | 34.2 | 255 | GAAA GA (GAAA)7 GAGA (GAAA)16 GAAG GAAA (GGAA)4 (AGAA)3 | 34.2* | 255 | GAAA GA (GAAA)8 GAGA (GAAA)15 GAAG GAAA (GGAA)4 (AGAA)3 | 35 | 257 | (GAAA)26 GAAG GAAA (GGAA)4 (AGAA)3 | 35.2 | 259 | GAAA GA (GAAA)6 GAGA (GAAA)18 GAAG GAAA (GGAA)4 (AGAA)3 | 36 | 261 | (GAAA)27 GAAG GAAA (GGAA)4 (AGAA)3 | 36.2 | 263 | GAAA GA (GAAA)6 GAGA (GAAA)19 GAAG GAAA (GGAA)4 (AGAA)3 | 37-40 | 265-277 | (GAAA)28-31GAAG GAAA (GGAA)4 (AGAA)3 | 40* | 277 | (GAAA)33 (GGAA)5 (AGAA)2 | 41-43 | 281-289 | (GAAA)32-34 GAAG GAAA (GGAA)4 (AGAA)3 | 43.3 | 292 | (GAAA)31 GAA (GAAA)3 GAAG GAAA (GGAA)4 (AGAA)3 | 44-50 | 293-317 | (GAAA)35 - 41 GAAG GAAA (GGAA)4 (AGAA)3 |
K562 (BRL) | 29 | K562 (Promega) | 29 | NA3657 | 38 | NA9947A | 36-38 | NA9948 | 31.2 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.1 | Germany (East) | Hering ... | 0.9439 | 0.9466 | 0.8916 | 0.9437 | 0.9439 | 0.8965 | 0.9945 | 0.9466 | 2 | Germany (North East) | Poetsch... | 0.9451 | 0.9476 | 0.8886 | 0.9398 | 0.9451 | 0.8985 | 0.9947 | 0.9476 | 3 | Latvia | Poetsch... | 0.9393 | 0.9423 | 0.8833 | 0.9394 | 0.9393 | 0.8886 | 0.9936 | 0.9423 | 4 | Taiwan | Chen MY... | 0.9541 | 0.9559 | 0.9086 | 0.9520 | 0.9541 | 0.9140 | 0.9962 | 0.9559 |
1 |
Germany (East) |
Caucasian (European) |
Hering ... |
1328 |
|
|
|
|
|
|
|
|
|
|
|
|
|
0.0005 |
|
0.0052 |
|
0.0147 |
0.0215 |
0.0042 |
0.0115 |
0.0262 |
0.0136 |
0.0649 |
0.0262 |
0.0842 |
0.0215 |
0.0382 |
0.0429 |
0.0204 |
0.0581 |
0.0047 |
0.0706 |
0.0026 |
0.0738 |
0.0816 |
0.0586 |
0.0701 |
0.0502 |
0.0481 |
0.0319 |
0.0005 |
0.0220 |
0.0173 |
0.0063 |
0.0052 |
0.0010 |
0.0010 |
0.0005 |
2 |
Germany (North East) |
Caucasian (European) |
Poetsch... |
205 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
0.0130 |
0.0390 |
0.0070 |
0.0100 |
0.0300 |
0.0100 |
0.0700 |
0.0500 |
0.0750 |
0.0230 |
0.0590 |
0.0430 |
0.0230 |
0.0330 |
0.0130 |
0.0750 |
0.0030 |
0.0590 |
0.0890 |
0.0100 |
0.0530 |
0.0560 |
0.0460 |
0.0530 |
|
0.0230 |
0.0160 |
0.0070 |
0.0070 |
|
|
|
3 |
Latvia |
Caucasian (European) |
Poetsch... |
152 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
0.0203 |
0.0270 |
|
0.0203 |
0.0811 |
0.0068 |
0.0946 |
0.0270 |
0.0743 |
|
0.0541 |
0.0405 |
0.0135 |
0.0676 |
0.0270 |
0.0743 |
|
0.0473 |
0.0878 |
0.0338 |
0.0676 |
0.0270 |
0.0338 |
0.0135 |
|
0.0203 |
0.0203 |
0.0135 |
0.0068 |
|
|
|
4 |
Taiwan |
all |
Chen MY... |
273 |
0.0050 |
0.0250 |
0.0470 |
0.0470 |
0.0080 |
0.0490 |
0.0110 |
0.0300 |
0.0470 |
0.0410 |
0.0490 |
0.0490 |
0.0380 |
0.0270 |
0.0050 |
0.0330 |
0.0080 |
0.0630 |
0.0550 |
|
0.0550 |
|
0.0680 |
|
0.0470 |
|
0.0550 |
|
0.0410 |
|
0.0270 |
|
0.0300 |
|
0.0080 |
0.0110 |
0.0050 |
0.0080 |
0.0030 |
|
|
|
0.0030 |
|
|
|
|
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system population st...
- Asamura H, Sakai H, Ota M, Fukushima H (2006) Japanese population data for eight X-STR loci using t...
- Bini C, Ceccardi S, Ferri G, Pelotti S, Alu M, Roncaglia E, Beduschi G, Caenazzo L, Ponzano E, Tasi...
- Bini C, Ceccardi S, Ferri G, Pelotti S, Alu M, Roncaglia E, Beduschi G, Caenazzo L, Ponzano E, Tasi...
- Chen MY, Pu CE (2004) Population data on the X chromosome short tandem repeat loci DXS10011, DXS101...
- Hering S, Brundirs N, Kuhlisch E, Edelmann J, Plate I, Benecke M, Van PH, Michael M, Szibor R (2004...
- Koyama H, Iwasa M, Tsuchimochi T, Maeno Y, Isobe I, Seko-Nakamura Y, Monma-Ohtaki J, Matsumoto T, N...
- Lee HY, Park MJ, Jeong CK, Lee SY, Yoo JE, Chung U, Choi JH, Kim CY, Shin KJ (2004) Genetic charact...
- Pelotti S, Bini C, Ceccardi S, Ferri G, Abbondanza A, Greggio NA, Ponzano E, Caenazzo L (2003) Sex ...
- Poetsch M, Petersmann H, Repenning A, Lignitz E (2005) Development of two pentaplex systems with X-...
- Poetsch M, Sabule A, Petersmann H, Volksone V, Lignitz E (2006) Population data of 10 X-chromosomal...
- Robino C, Giolitti A, Gino S, Torre C (2006) Development of two multiplex PCR systems for the analy...
- Rodrigues EMR, Leite FPDN, Hutz MH, Palha TDBF, dos Santos AKCR, dos Santos SEB (2008) A multiplex ...
- Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1:93-99
- Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked markers for...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
- Matsuki T, Sawazaki K, Tsubota E, Iida R (2003) DXS10011: a hypervariable TTTC/GAAA repeat marker o...
NoteNo data.
|
|
News
Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.
|
|