ChrX-STR.org 2.0
Database and information hub for forensic X-chromosomal markers



Marker DXS10074

Create date: Jun 25, 2009 12:18:12 PM
Last update: Jul 13, 2011 9:38:41 AM
Linkage group: X2
Cytogenetic localisation: q 12.00
Physical localisation NCBI 36: 66.894
Rutgers Map v.2: 90.83
Reference: Hering S, Augustin C, Edelmann J, Heidel M, Dressler J, Rodig H, Kuhlisch E, Sz...

Primer

PrimerF: 5' - TAGGCGCTTCCTAGACCTCA - 3'
PrimerR: 5' - CCTTCCTTCCCATGTTCTCA - 3'

Typical structure

AllelebpsSequence composition
13-21195-227(AAGA)10-18 AAGG (AAGA)2
16.2209AA (AAGA)13 AAGG (AAGA)2
7-10165-177(AAGA)7-10
References: Hering S, Augustin C, Edelmann J, Heidel M, Dressler J, Rodig H, Kuhlisch E, Sz...

Cell line DNAAllele
9947A (Promega)16-19
K562 (Promega, Gibco)17
NA 3567 (Coriell)7
NA 9948 (Coriell)18
References: Hering S, Augustin C, Edelmann J, Heidel M, Dressler J, Rodig H, Kuhlisch E, Sz...

Population data

The values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.
IDPopulationReferencePICHETMEC KrügerMEC KishidaMEC DesmaraisMEC Desmarais duoPD femalePD male
1China (Guangdong)Genetic...0.73410.76950.55750.73410.73410.60100.91150.7695
2GermanyBecker ...0.81280.83260.67170.81220.81280.70040.95210.8326
3GermanyBecker ...0.82040.84000.68100.82010.82040.71000.95480.8400
4GermanyBecker ...0.81760.83720.67800.81710.81760.70660.95390.8372
5GhanaBecker ...0.85560.86930.73700.85530.85560.75870.96920.8693
6Japan (Fukuoka)Becker ...0.73570.76730.56300.73570.73570.60260.91420.7673
ID Population Ethnic specification Reference n* 6 7 8 9 10 11 12 13 14 15 15.2 15.3 16 16.2 17 18 18.3 19 19.3 20 21
1 China (Guangdong) Asian (Chinese Han) Genetic... 272 both 0.0050 0.0050 0.0575 0.0025 0.1425 0.3050 0.3000 0.0025 0.1525 0.0225 0.0050
2 Germany Caucasian (European) Becker ... 278 females 0.0866 0.1462 0.0090 0.0018 0.0018 0.0162 0.0613 0.2725 0.2111 0.1083 0.0595 0.0018 0.0162 0.0072
3 Germany Caucasian (European) Becker ... 439 males 0.0706 0.1435 0.0068 0.0023 0.0023 0.0091 0.0728 0.2050 0.0023 0.2300 0.1731 0.0615 0.0159 0.0045
4 Germany Caucasian (European) Becker ... 717 0.0813 0.1453 0.0083 0.0007 0.0012 0.0019 0.0138 0.0652 0.2500 0.0007 0.2174 0.1299 0.0602 0.0012 0.0161 0.0063
5 Ghana all Becker ... 59 males 0.0169 0.1186 0.0169 0.0678 0.0847 0.1186 0.1356 0.1695 0.0169 0.2034 0.0169 0.0339
6 Japan (Fukuoka) Asian (Japanese) Becker ... 93 males 0.0108 0.1075 0.1828 0.3763 0.1828 0.1075 0.0323
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.

References

Note

News

Based on the review of december 2018, it has been decided in cooperation with the X working group to remove the PI calculation from this website.